Jatropha Genome Database

JcCA0270781.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0270781.10 - phase: 1 /partial
         (1436 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

60499.m000013 aromatic amino acid decarboxylase, putative              58   2e-07
29950.m001181 aromatic amino acid decarboxylase, putative              52   9e-06
27544.m000014 aromatic amino acid decarboxylase, putative              52   9e-06

>60499.m000013 aromatic amino acid decarboxylase, putative
          Length = 719

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                      
Query: 1  tagacttcattgctgattattatcagaacatcgaaaaacacccagttttaagccaggttg 60
          |||| ||||||||||| |||||  | ||||| |||||| ||||||||  |||||||||| 
Sbjct: 8  tagatttcattgctgagtattacaaaaacatagaaaaatacccagttcaaagccaggttc 67

                       
Query: 61 aacctggttatct 73
          ||||||| |||||
Sbjct: 68 aacctggatatct 80


>29950.m001181 aromatic amino acid decarboxylase, putative
          Length = 1338

 Score = 52.0 bits (26), Expect = 9e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 1128 gacaaaaggtttgagatagttgtgccgaggaattttgcaatggtttgcttcagg 1181
            ||||| |||||||||||||| ||||| || || |||||  ||||||||||||||
Sbjct: 1069 gacaagaggtttgagatagtggtgccaagaaagtttgctttggtttgcttcagg 1122


>27544.m000014 aromatic amino acid decarboxylase, putative
          Length = 523

 Score = 52.0 bits (26), Expect = 9e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 1128 gacaaaaggtttgagatagttgtgccgaggaattttgcaatggtttgcttcagg 1181
            ||||| |||||||||||||| ||||| || || |||||  ||||||||||||||
Sbjct: 259  gacaagaggtttgagatagtggtgccaagaaaatttgctttggtttgcttcagg 312