Jatropha Genome Database

JcCA0266291.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0266291.20 + phase: 1 /pseudo/partial
         (361 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29648.m002008 beta-galactosidase, putative                            149   1e-35
30074.m001370 beta-galactosidase, putative                             62   2e-09

>29648.m002008 beta-galactosidase, putative
          Length = 2316

 Score =  149 bits (75), Expect = 1e-35
 Identities = 147/171 (85%)
 Strand = Plus / Plus

                                                                        
Query: 71   aaacgatgttgccttactcagtgcaacagttggattaccgaatgcaggagcatatcttga 130
            |||| ||||||||||||| |||| |||||| ||||||||| || ||||||||||||||||
Sbjct: 1539 aaacaatgttgccttactaagtgtaacagtcggattaccggattcaggagcatatcttga 1598

                                                                        
Query: 131  gcgtaagattgctggattacgtagagtaagccttcaaaacaaggatttcactagatatga 190
             |||| | |||||||||||| ||| |||||  |||| ||||||||||||||||  ||   
Sbjct: 1599 acgtagggttgctggattacatagggtaagaattcagaacaaggatttcactacttactc 1658

                                                               
Query: 191  atggggatatcaggttggattggtgggagaggagttacaaatttacacaga 241
            |||||||||||||||||| ||| | |||||| ||||||| |||||||||||
Sbjct: 1659 atggggatatcaggttgggttgttaggagagaagttacagatttacacaga 1709


>30074.m001370 beta-galactosidase, putative
          Length = 2487

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 191  atggggatatcaggttggattggtgggagaggagttacaaatttacacaga 241
            ||||||||||||||| |||||| | |||||| |||||||||||| ||||||
Sbjct: 1722 atggggatatcaggtaggattgcttggagagaagttacaaattttcacaga 1772