Jatropha Genome Database

JcCA0262331.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0262331.10 - phase: 0 
         (237 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30068.m002599 conserved hypothetical protein                           78   3e-14

>30068.m002599 conserved hypothetical protein
          Length = 234

 Score = 77.8 bits (39), Expect = 3e-14
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 160 tccttagacaaggagaaattcgcgccaagatttgatgggttaaggttcatagagaccctg 219
           |||| |||||||||||||||||||||| |||||||||| || |||||||| || ||||| 
Sbjct: 157 tcctcagacaaggagaaattcgcgccacgatttgatggtttgaggttcattgaaacccta 216

                      
Query: 220 attacagctca 230
           ||||| |||||
Sbjct: 217 attacggctca 227