Jatropha Genome Database

JcCA0261271.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0261271.10 + phase: 0 
         (405 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30068.m002536 conserved hypothetical protein                          167   6e-41

>30068.m002536 conserved hypothetical protein
          Length = 1149

 Score =  167 bits (84), Expect = 6e-41
 Identities = 174/204 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaccgaagtggccagctcagttgtgcacgaggtgctcggccctcgagtccaggatgtg 60
           ||||| |||||||| |  ||||| || ||||||||||| ||||  || |||||||| |||
Sbjct: 1   atgacggaagtggctacttcagtggttcacgaggtgctaggccgccgtgtccaggacgtg 60

                                                                       
Query: 61  gatcagccaattgtcgactacatcatcaacgttctagctgatgaggacttcgatttcggt 120
           |||||||||||||| || ||||| |||||||| || || |||||||| |||||||| || 
Sbjct: 61  gatcagccaattgttgattacataatcaacgtcctcgcagatgaggatttcgattttggc 120

                                                                       
Query: 121 gaggaaggcgaaggtgcttttgaagctcttggtgaactcctcgtcggcgccggatgcgtc 180
           ||||||||||||||||| ||||| ||| | ||||||||||||||||||||||| ||||| 
Sbjct: 121 gaggaaggcgaaggtgcctttgatgctatcggtgaactcctcgtcggcgccggttgcgtt 180

                                   
Query: 181 tccgactttgaagagtgccgtctg 204
           || || ||||| ||||| ||||||
Sbjct: 181 tctgattttgatgagtgtcgtctg 204



 Score =  159 bits (80), Expect = 2e-38
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                       
Query: 207 aaaaccaacagtgcggagccttacagcacctataagaatgaatgatggaatggatgagga 266
           ||||||| ||||||||||||||||| | ||| | ||||||||||| ||||||||||||||
Sbjct: 255 aaaaccagcagtgcggagccttacaacgccttttagaatgaatgaaggaatggatgagga 314

                                                                       
Query: 267 ggtcccaaagaagaagcctgaggttatggaaggtcctgtgctgtccgagcgtgaccgtgc 326
            || |||||||| ||||||||||| || || |||||| ||||| | ||||||||||||||
Sbjct: 315 tgtgccaaagaaaaagcctgaggtgatcgatggtcctttgctgactgagcgtgaccgtgc 374

                                                       
Query: 327 aaagatagagaggagaaagagaaaggaggagcgccaaagagagg 370
            ||| |||||||||||||||| ||||| ||||| ||| ||||||
Sbjct: 375 taagctagagaggagaaagaggaaggacgagcgtcaacgagagg 418