Jatropha Genome Database

JcCA0261141.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0261141.10 - phase: 0 
         (1047 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28049.m000300 Ethylene-responsive transcription factor, putative      131   9e-30
29904.m002941 hypothetical protein                                     56   4e-07
29895.m000321 Ethylene-responsive transcription factor 1B, putative    54   2e-06

>28049.m000300 Ethylene-responsive transcription factor, putative
          Length = 900

 Score =  131 bits (66), Expect = 9e-30
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 349 taccgtggtgttcgacaaagaccatggggaagatttgcagctgaaattagagacccatcc 408
           ||||| |||||| ||||||| ||||||||||||||||| || |||||||| |||||    
Sbjct: 328 taccgcggtgttagacaaaggccatggggaagatttgcggcggaaattagggacccggtt 387

                                                                       
Query: 409 cgacgaacgagaatatggttagggacttttgatactgcagaggaggctgcaatggtttat 468
           ||  |||| || |||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 388 cggagaacaaggatatggttagggacatttgacacagcagaggaggctgctatggtttat 447

                                     
Query: 469 gataaagctgctatacaaattaaagg 494
           |||||||||||| | |||||||||||
Sbjct: 448 gataaagctgctcttcaaattaaagg 473


>29904.m002941 hypothetical protein
          Length = 1401

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 424 tggttagggacttttgatactgcagaggaggctgcaatggtttatgataaagctgc 479
           ||||||||||| |||||||| ||||| || ||||| |||| |||||||| ||||||
Sbjct: 883 tggttagggacatttgatacagcagaagaagctgctatggcttatgatacagctgc 938


>29895.m000321 Ethylene-responsive transcription factor 1B, putative
          Length = 675

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 422 tatggttagggacttttgatactgcagaggaggctgcaatggtttatgataaagctgct 480
           ||||||||||||| ||||||| ||||||||  |||||  ||| ||||||| ||||||||
Sbjct: 329 tatggttagggacatttgatagtgcagaggcagctgctctggcttatgatcaagctgct 387