Jatropha Genome Database

JcCA0257621.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0257621.10 - phase: 0 
         (282 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29738.m000999 RNA binding protein, putative                           109   9e-24

>29738.m000999 RNA binding protein, putative
          Length = 5235

 Score =  109 bits (55), Expect = 9e-24
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                       
Query: 38  tctcttctctctcaagcagctttaaacaagtccctttgccagctatcccaccaatgcttg 97
           |||||||||| ||||| ||||||||| ||||||||||  ||||||| ||| |||| ||||
Sbjct: 14  tctcttctctatcaagaagctttaaaaaagtccctttatcagctataccagcaattcttg 73

                                                      
Query: 98  attgcattttagcatccacaggcttgtcttcagcttcactttt 140
           |||||||||||||||| |||||||| ||| || ||||||||||
Sbjct: 74  attgcattttagcatcaacaggcttatctccatcttcactttt 116