Jatropha Genome Database

JcCA0257171.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0257171.10 + phase: 0 
         (1557 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29758.m000655 conserved hypothetical protein                           56   7e-07

>29758.m000655 conserved hypothetical protein
          Length = 219

 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 52/59 (88%), Gaps = 2/59 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1480 gaccttacaaggcgattactgggtgaagagagttacaagatcaagcatatttcaaaagt 1538
            ||||||||||||||| | |  ||||||||||  |||||||||||||| |||||||||||
Sbjct: 160  gaccttacaaggcgactgcaaggtgaagaga--tacaagatcaagcacatttcaaaagt 216