Jatropha Genome Database
- JcCA0257171.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0257171.10 + phase: 0
(1557 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29758.m000655 conserved hypothetical protein 56 7e-07
>29758.m000655 conserved hypothetical protein
Length = 219
Score = 56.0 bits (28), Expect = 7e-07
Identities = 52/59 (88%), Gaps = 2/59 (3%)
Strand = Plus / Plus
Query: 1480 gaccttacaaggcgattactgggtgaagagagttacaagatcaagcatatttcaaaagt 1538
||||||||||||||| | | |||||||||| |||||||||||||| |||||||||||
Sbjct: 160 gaccttacaaggcgactgcaaggtgaagaga--tacaagatcaagcacatttcaaaagt 216