Jatropha Genome Database

JcCA0254771.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0254771.20 + phase: 0 
         (300 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014181 Gibberellin-regulated protein 1 precursor, putative     170   3e-42
30170.m014182 conserved hypothetical protein                           86   1e-16
30170.m014180 Gibberellin-regulated protein 1 precursor, putative      56   1e-07

>30170.m014181 Gibberellin-regulated protein 1 precursor, putative
          Length = 306

 Score =  170 bits (86), Expect = 3e-42
 Identities = 164/190 (86%)
 Strand = Plus / Plus

                                                                       
Query: 111 gaaaattgactgtggtagcgcctgtagtaataggtgccggttagcttcgagacaaaggtt 170
           |||||| ||||||| ||||||||| |  |  |||||||| ||||| || || |||||| |
Sbjct: 117 gaaaatagactgtgctagcgcctgcaagacaaggtgccgcttagcgtcaaggcaaaggat 176

                                                                       
Query: 171 atgccatagggcatgtgggacttgctgtgcacgctgcaactgtgttccgccgggaacttc 230
            |||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 177 gtgccatagggcatgtgggacgtgctgtgcacgctgcaactgtgtacctccgggaacttc 236

                                                                       
Query: 231 cggcaaccatgaggtctgcccctgctacgctagcttgactactcacggtggtcggcgcaa 290
           ||| ||||||||   ||||| ||||||||| ||||||  ||||||||||||||| | |||
Sbjct: 237 cggtaaccatgaatcctgccgctgctacgccagcttgcttactcacggtggtcgactcaa 296

                     
Query: 291 gtgtccttga 300
           ||||||||||
Sbjct: 297 gtgtccttga 306


>30170.m014182 conserved hypothetical protein
          Length = 237

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 178 agggcatgtgggacttgctgtgcacgctgcaactgtgttccgccgggaacttccggcaac 237
           |||||||||||||||||||||||||| |||| ||||||||| || || ||| |||| |||
Sbjct: 147 agggcatgtgggacttgctgtgcacgttgcagctgtgttcctcctggtactgccggtaac 206

                                          
Query: 238 catgaggtctgcccctgctacgctagcttga 268
            |||| | ||| ||||||||||| |||||||
Sbjct: 207 tatgatgcctgtccctgctacgccagcttga 237


>30170.m014180 Gibberellin-regulated protein 1 precursor, putative
          Length = 291

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 209 actgtgttccgccgggaacttccggcaaccatgaggtctgcccctgctacgc 260
           |||||||||| |||||||||||||||||| | || || || |||||||||||
Sbjct: 200 actgtgttccaccgggaacttccggcaactacgacgtatgtccctgctacgc 251