Jatropha Genome Database

JcCA0254771.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0254771.10 + phase: 0 
         (312 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014182 conserved hypothetical protein                          147   4e-35
30170.m014181 Gibberellin-regulated protein 1 precursor, putative      94   6e-19
30170.m014180 Gibberellin-regulated protein 1 precursor, putative      68   3e-11

>30170.m014182 conserved hypothetical protein
          Length = 237

 Score =  147 bits (74), Expect = 4e-35
 Identities = 125/142 (88%)
 Strand = Plus / Plus

                                                                       
Query: 139 agcgcttgcacagccaggtgtcagttatcgtcaaggccaaacctatgcaagagggcatgc 198
           ||||||||||| |||||||| |||||||| || ||||||  |||||||||||||||||| 
Sbjct: 96  agcgcttgcacggccaggtgccagttatcatcgaggccacgcctatgcaagagggcatgt 155

                                                                       
Query: 199 gggacatgctgtgcccgttgcaagtgtgttccgccgggaactgccggtaactatgaggcc 258
           ||||| |||||||| |||||||  |||||||| || || ||||||||||||||||| |||
Sbjct: 156 gggacttgctgtgcacgttgcagctgtgttcctcctggtactgccggtaactatgatgcc 215

                                 
Query: 259 tgcccctgttacgccagcttga 280
           || ||||| |||||||||||||
Sbjct: 216 tgtccctgctacgccagcttga 237



 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                       
Query: 1  atggccttctccaagcttctgattgcttc 29
          |||||| ||||||||||||||||||||||
Sbjct: 1  atggccatctccaagcttctgattgcttc 29


>30170.m014181 Gibberellin-regulated protein 1 precursor, putative
          Length = 306

 Score = 93.7 bits (47), Expect = 6e-19
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                       
Query: 190 agggcatgcgggacatgctgtgcccgttgcaagtgtgttccgccgggaactgccggtaac 249
           |||||||| ||||| |||||||| || ||||| ||||| || ||||||||| ||||||||
Sbjct: 184 agggcatgtgggacgtgctgtgcacgctgcaactgtgtacctccgggaacttccggtaac 243

                                                                       
Query: 250 tatgaggcctgcccctgttacgccagcttgactacccatggtggccgacgcaagtgtcct 309
            ||||  |||||| ||| ||||||||||||  ||| || ||||| |||| ||||||||||
Sbjct: 244 catgaatcctgccgctgctacgccagcttgcttactcacggtggtcgactcaagtgtcct 303

              
Query: 310 tga 312
           |||
Sbjct: 304 tga 306


>30170.m014180 Gibberellin-regulated protein 1 precursor, putative
          Length = 291

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 154 aggtgtcagttatcgtcaaggccaaacctatgcaagagggcatgcgggacatgctgtgcc 213
           |||||||| || || || |||||| |||| ||||||||||||||||| || ||||||| |
Sbjct: 133 aggtgtcaattgtcatcgaggccacacctgtgcaagagggcatgcggtacctgctgtgtc 192

                                                 
Query: 214 cgttgcaagtgtgttccgccgggaactgccggtaacta 251
           || ||  | |||||||| ||||||||| |||| |||||
Sbjct: 193 cgatgtgactgtgttccaccgggaacttccggcaacta 230