Jatropha Genome Database

JcCA0251011.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0251011.10 - phase: 0 
         (207 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30138.m003939 mads box protein, putative                              208   9e-54
30174.m008934 mads box protein, putative                               66   8e-11

>30138.m003939 mads box protein, putative
          Length = 735

 Score =  208 bits (105), Expect = 9e-54
 Identities = 165/185 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaaggggtagggttcagttaaagagaattgaaaacaagattaataggcaagtcact 60
           ||||| || |||||||||||| | |||||||||||||||||||||||||||||||| || 
Sbjct: 1   atggggagaggtagggttcagctgaagagaattgaaaacaagattaataggcaagtgacc 60

                                                                       
Query: 61  ttttcgaaaagaaggtctggtttgctgaagaaagctcatgagatctctgttctttgtgat 120
           ||||| ||||||||| |||| ||| |||||||||| |||||||||||||||||||| |||
Sbjct: 61  ttttcaaaaagaagggctggattgttgaagaaagcccatgagatctctgttctttgcgat 120

                                                                       
Query: 121 gctgaggttgctttgattgtcttctccactaaagggaagcttttcgaatactctaccgat 180
           ||||| |||||||||||||| || || ||||||||||| || || ||||||||||| |||
Sbjct: 121 gctgaagttgctttgattgttttttctactaaagggaaactctttgaatactctactgat 180

                
Query: 181 tcctg 185
           |||||
Sbjct: 181 tcctg 185


>30174.m008934 mads box protein, putative
          Length = 735

 Score = 65.9 bits (33), Expect = 8e-11
 Identities = 105/129 (81%)
 Strand = Plus / Plus

                                                                       
Query: 20  agttaaagagaattgaaaacaagattaataggcaagtcactttttcgaaaagaaggtctg 79
           |||| ||||| || |||||||| || ||| | ||||| || || || ||||| |||  ||
Sbjct: 20  agttgaagaggatagaaaacaaaatcaatcgccaagtgaccttctctaaaaggaggaatg 79

                                                                       
Query: 80  gtttgctgaagaaagctcatgagatctctgttctttgtgatgctgaggttgctttgattg 139
           | ||| |||| |||||| ||||| | ||||| ||||||||||||||||||||| | ||| 
Sbjct: 80  gattgttgaaaaaagcttatgagctgtctgtgctttgtgatgctgaggttgctcttatta 139

                    
Query: 140 tcttctcca 148
           |||||||||
Sbjct: 140 tcttctcca 148