Jatropha Genome Database

JcCA0247421.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0247421.10 + phase: 1 /partial
         (197 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29830.m001422 DNA-damage-inducible protein f, putative                117   2e-26
30122.m000355 DNA-damage-inducible protein f, putative                 54   3e-07

>29830.m001422 DNA-damage-inducible protein f, putative
          Length = 1344

 Score =  117 bits (59), Expect = 2e-26
 Identities = 71/75 (94%)
 Strand = Plus / Plus

                                                                        
Query: 1    accgatcaatgctctggcttatatctttgatggtcttcattatggtatatcagacttttc 60
            ||||||||||||| | |||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1092 accgatcaatgctatagcttatatttttgatggtcttcattatggaatatcagacttttc 1151

                           
Query: 61   atatgctgcttggtc 75
            |||||||||||||||
Sbjct: 1152 atatgctgcttggtc 1166



 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                        
Query: 80   tcttttcatgggaatgagaacaatagctggatatatgagattattatcgagaaacgggcc 139
            ||||||||||||  || | ||| |||| ||||||||||||||| |||| |  || |||||
Sbjct: 1254 tcttttcatgggtttgcggacagtagccggatatatgagattagtatccaagaaggggcc 1313

                                     
Query: 140  gtggtggttcctgcaggacgacatt 164
             ||||||||||||| ||| ||||||
Sbjct: 1314 atggtggttcctgctggatgacatt 1338


>30122.m000355 DNA-damage-inducible protein f, putative
          Length = 1818

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 8    aatgctctggcttatatctttgatggtcttcattatggtatatcagacttttcatatgc 66
            ||||||||||||| ||| |||||||| ||||| |||||| | || |||||| |||||||
Sbjct: 1507 aatgctctggcttttatttttgatggccttcactatggtgtttctgactttgcatatgc 1565