Jatropha Genome Database

JcCA0246931.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0246931.10 - phase: 0 /partial
         (417 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29579.m000198 UDP-glucosyltransferase, putative                       103   8e-22
29801.m003126 UDP-glucosyltransferase, putative                        66   2e-10
29806.m000964 UDP-glucuronosyltransferase, putative                    58   4e-08
29801.m003142 UDP-glucosyltransferase, putative                        58   4e-08
30078.m002216 UDP-glucosyltransferase, putative                        54   7e-07
29827.m002568 UDP-glucosyltransferase, putative                        52   3e-06
29801.m003143 UDP-glucosyltransferase, putative                        52   3e-06

>29579.m000198 UDP-glucosyltransferase, putative
          Length = 1479

 Score =  103 bits (52), Expect = 8e-22
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                        
Query: 13   tcacacccagcaattggaggatttgtgacgcattgtggatggaattcaacattggaagca 72
            ||||| || ||||||||||| ||| |||| ||||| || |||||||||||||||||||||
Sbjct: 1072 tcacatcctgcaattggaggttttctgacacattgcggttggaattcaacattggaagca 1131

                                                                        
Query: 73   ataagctcaggtgtgccgatggctacatggccactttttgcatatcaatttattaatgag 132
            ||||   | ||  |||| |||| ||||||||||||||| ||  | ||||||  |||||||
Sbjct: 1132 ataactgccggattgcctatggttacatggccacttttcgcggaccaattttgtaatgag 1191

                                            
Query: 133  aagctagttattcaggtactgaagattggtgt 164
            ||| | ||| |||| |||||||||||||||||
Sbjct: 1192 aagttggttgttcaagtactgaagattggtgt 1223


>29801.m003126 UDP-glucosyltransferase, putative
          Length = 1164

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 25   attggaggatttgtgacgcattgtggatggaattcaacatt 65
            |||||||||||| |||| |||||||||||||||||||||||
Sbjct: 1075 attggaggatttatgactcattgtggatggaattcaacatt 1115


>29806.m000964 UDP-glucuronosyltransferase, putative
          Length = 1425

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 23   caattggaggatttgtgacgcattgtggatggaattcaaca 63
            |||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 1097 caattggagggtttctgacacattgtggatggaattcaaca 1137


>29801.m003142 UDP-glucosyltransferase, putative
          Length = 1440

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                        
Query: 21   agcaattggaggatttgtgacgcattgtggatggaattcaacattggaagcaataagctc 80
            ||||||||||||||| || || ||||| ||||||||||||||  | |||||||||    |
Sbjct: 1074 agcaattggaggattcgtaactcattgcggatggaattcaacgcttgaagcaatagcggc 1133

                                     
Query: 81   aggtgtgccgatggctacatggcca 105
            ||| ||||| |||| ||||||||||
Sbjct: 1134 aggagtgccaatggttacatggcca 1158


>30078.m002216 UDP-glucosyltransferase, putative
          Length = 1452

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 13   tcacacccagcaattggaggatttgtgacgcattgtggatggaattc 59
            |||||||| ||||||||||||||  |||| |||||||| ||||||||
Sbjct: 1066 tcacaccctgcaattggaggattcctgacacattgtggttggaattc 1112


>29827.m002568 UDP-glucosyltransferase, putative
          Length = 1437

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 46   tgtggatggaattcaacattggaagcaata 75
            |||||||||||||||||| |||||||||||
Sbjct: 1126 tgtggatggaattcaacagtggaagcaata 1155


>29801.m003143 UDP-glucosyltransferase, putative
          Length = 1461

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 22   gcaattggaggatttgtgacgcattgtggatggaattcaaca 63
            |||||||||||||| || || |||||||||||||| ||||||
Sbjct: 1096 gcaattggaggattcgttactcattgtggatggaactcaaca 1137