Jatropha Genome Database

JcCA0224821.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0224821.10 + phase: 0 
         (495 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28200.m000194 Acid beta-fructofuranosidase precursor, putative        107   6e-23
30147.m014213 Beta-fructofuranosidase, soluble isoenzyme I precu...    72   3e-12

>28200.m000194 Acid beta-fructofuranosidase precursor, putative
          Length = 1950

 Score =  107 bits (54), Expect = 6e-23
 Identities = 75/82 (91%)
 Strand = Plus / Plus

                                                                       
Query: 347 cgccagactatccatggaacaatagcatgttatcatggcaaagaactgctttccatttcc 406
           ||||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||
Sbjct: 317 cgccagagtatccatggaataatagtatgttatcatggcaaagaagtgctttccatttcc 376

                                 
Query: 407 aacctgagaagaattggatgaa 428
           |||| || ||||| ||||||||
Sbjct: 377 aacccgaaaagaactggatgaa 398


>30147.m014213 Beta-fructofuranosidase, soluble isoenzyme I
           precursor, putative
          Length = 1920

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 373 atgttatcatggcaaagaactgctttccatttccaacctgagaagaattggatgaatggt 432
           ||||| || |||||||||||||||| ||| || ||||||||||| |||||||||||||||
Sbjct: 334 atgttgtcttggcaaagaactgcttaccactttcaacctgagaaaaattggatgaatggt 393