Jatropha Genome Database

JcCA0221281.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0221281.10 + phase: 0 
         (303 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29680.m001663 conserved hypothetical protein                           50   8e-06

>29680.m001663 conserved hypothetical protein
          Length = 315

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 98  aaatccaatctcttgcgaggggaaaggtgccatcatc 134
           |||| ||||||||||||||||| ||||| ||||||||
Sbjct: 128 aaatacaatctcttgcgaggggcaaggtcccatcatc 164