Jatropha Genome Database

JcCA0192731.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0192731.10 + phase: 0 /pseudo/partial
         (267 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29719.m000334 conserved hypothetical protein                          100   8e-21

>29719.m000334 conserved hypothetical protein
          Length = 1095

 Score = 99.6 bits (50), Expect = 8e-21
 Identities = 74/82 (90%)
 Strand = Plus / Plus

                                                                       
Query: 9   ttggctgttgtcgctatggctggactagctgcagagggcctgcagtatgacaaagtcatt 68
           ||||||||||| || ||||||||||| |||||||| || || ||||||||||||||  ||
Sbjct: 679 ttggctgttgtagcaatggctggacttgctgcagaagggcttcagtatgacaaagtggtt 738

                                 
Query: 69  ggtcaatctgctgatcttttca 90
           ||||||||||||||||||||||
Sbjct: 739 ggtcaatctgctgatcttttca 760