Jatropha Genome Database
- JcCA0192231.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0192231.10 + phase: 0 /partial/short
(135 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30189.m001658 protein phosphatase 2c, putative 143 3e-34
>30189.m001658 protein phosphatase 2c, putative
Length = 888
Score = 143 bits (72), Expect = 3e-34
Identities = 117/132 (88%)
Strand = Plus / Plus
Query: 4 atgcagaatcaagaggcagttgatttggtgaaacctattaaggatccgcaggctgctgct 63
||||| ||||||||||||||||||||||||||||| |||||||||||||| || |||||
Sbjct: 754 atgcaaaatcaagaggcagttgatttggtgaaacccattaaggatccgcaagcggctgcc 813
Query: 64 aggcggttaacgactgaagcattgacaagaaagagtaaggatgacatatcatgcatcgtg 123
| ||| || || ||||| ||||| |||||||||| |||||||| ||||||||||| |||
Sbjct: 814 aagcgcttgacaactgaggcattagcaagaaagagcaaggatgatatatcatgcattgtg 873
Query: 124 atccgttttgga 135
||||||||||||
Sbjct: 874 atccgttttgga 885