Jatropha Genome Database

JcCA0192231.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0192231.10 + phase: 0 /partial/short
         (135 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30189.m001658 protein phosphatase 2c, putative                        143   3e-34

>30189.m001658 protein phosphatase 2c, putative
          Length = 888

 Score =  143 bits (72), Expect = 3e-34
 Identities = 117/132 (88%)
 Strand = Plus / Plus

                                                                       
Query: 4   atgcagaatcaagaggcagttgatttggtgaaacctattaaggatccgcaggctgctgct 63
           ||||| ||||||||||||||||||||||||||||| |||||||||||||| || ||||| 
Sbjct: 754 atgcaaaatcaagaggcagttgatttggtgaaacccattaaggatccgcaagcggctgcc 813

                                                                       
Query: 64  aggcggttaacgactgaagcattgacaagaaagagtaaggatgacatatcatgcatcgtg 123
           | ||| || || ||||| |||||  |||||||||| |||||||| ||||||||||| |||
Sbjct: 814 aagcgcttgacaactgaggcattagcaagaaagagcaaggatgatatatcatgcattgtg 873

                       
Query: 124 atccgttttgga 135
           ||||||||||||
Sbjct: 874 atccgttttgga 885