Jatropha Genome Database

JcCA0163731.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0163731.10 + phase: 2 /partial
         (1015 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30169.m006282 cytochrome P450, putative                                54   2e-06

>30169.m006282 cytochrome P450, putative
          Length = 1494

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 809  cttccatttggtgcaggaaaaagagtatgccctgg 843
            |||||||||||||||||||| ||| ||||||||||
Sbjct: 1285 cttccatttggtgcaggaaagagaatatgccctgg 1319