Jatropha Genome Database

JcCA0155101.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0155101.30 + phase: 0 
         (219 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27524.m000291 conserved hypothetical protein                           78   2e-14

>27524.m000291 conserved hypothetical protein
          Length = 573

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                      
Query: 1  atgggagaaggtaaaggctcaacgctggttcaccttctggtggtggttctgtgccttgtt 60
          ||||||||||| ||||| || || || || || ||||| |||||||||||  | ||||||
Sbjct: 1  atgggagaagggaaaggatcgactctagtacatcttctagtggtggttcttagtcttgtt 60

                                                 
Query: 61 gcctttggattcgccattgctgccgagagacgaagaagc 99
          || |||||||| ||||||||||| || ||||||||||||
Sbjct: 61 gcttttggatttgccattgctgctgaaagacgaagaagc 99