Jatropha Genome Database

JcCA0155101.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0155101.10 + phase: 0 
         (342 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27524.m000289 hypothetical protein                                    172   9e-43

>27524.m000289 hypothetical protein
          Length = 369

 Score =  172 bits (87), Expect = 9e-43
 Identities = 111/119 (93%)
 Strand = Plus / Plus

                                                                       
Query: 193 gtggatgagcaaatgtcgtgggggtcaatttggttgccgttttgggatgtggagtacatg 252
           ||||||||||| ||||| ||||||||||||||||||||  ||||||||||||||||||||
Sbjct: 220 gtggatgagcagatgtcatgggggtcaatttggttgcctgtttgggatgtggagtacatg 279

                                                                      
Query: 253 ggtgaggcttgcagtgaaatgtttagtgatgtggtttgggattatgatatttggaactt 311
           || |||||||||||||||||||| ||||||||  |||||||||||||||||||||||||
Sbjct: 280 ggcgaggcttgcagtgaaatgttcagtgatgttatttgggattatgatatttggaactt 338