Jatropha Genome Database

JcCA0155091.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0155091.10 - phase: 0 /partial
         (258 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m008934 mads box protein, putative                               60   7e-09
30170.m013776 mads box protein, putative                               56   1e-07

>30174.m008934 mads box protein, putative
          Length = 735

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 115 tgtgatgctgaggttgctgttattatcttctcca 148
           |||||||||||||||||| |||||||||||||||
Sbjct: 115 tgtgatgctgaggttgctcttattatcttctcca 148


>30170.m013776 mads box protein, putative
          Length = 693

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                  
Query: 20 agatcaagaggattgagaatgcaaacagcaggcaagttacattctctaaaaggaga 75
          |||||||||| ||||||||| |||  | ||||||||| || |||||||||||||||
Sbjct: 20 agatcaagagaattgagaatacaacaaacaggcaagtcaccttctctaaaaggaga 75