Jatropha Genome Database

JcCA0154801.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0154801.30 + phase: 0 
         (207 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m007261 conserved hypothetical protein                           94   4e-19

>30131.m007261 conserved hypothetical protein
          Length = 663

 Score = 93.7 bits (47), Expect = 4e-19
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                       
Query: 93  taaaattctacaagttggtgctgtgcagaaaattttcaggcagttgtttagagttaaaga 152
           ||||||||| |||||||||| |||| |||||||||||| ||||||||||||||||  |||
Sbjct: 261 taaaattcttcaagttggtggtgtggagaaaattttcaagcagttgtttagagttggaga 320

                          
Query: 153 agaagagaaattgtt 167
           ||| |||||||||||
Sbjct: 321 agatgagaaattgtt 335