Jatropha Genome Database
- JcCA0154641.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0154641.10 - phase: 0
(390 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29732.m000318 conserved hypothetical protein 82 3e-15
>29732.m000318 conserved hypothetical protein
Length = 1107
Score = 81.8 bits (41), Expect = 3e-15
Identities = 161/201 (80%)
Strand = Plus / Plus
Query: 49 tacgacgttgagtaccgcgcaatcgcagacgacgcatggtactccgtccgtacagtgctt 108
|||||||| |||||||| ||||| || ||||||||||||||| ||||||||||| |
Sbjct: 52 tacgacgtcgagtaccgtgcaatagccgacgacgcatggtacagtgtccgtacagttgta 111
Query: 109 aacggggagaaactgacggtgaagtacgacaacttcagcgatgaaaacgacagcattttc 168
| || |||| ||||| | | |||||||| |||||| |||||||| |||||||| | ||
Sbjct: 112 gaaggagagacactgaggattaagtacgaaaacttcggcgatgaacacgacagcgtcttt 171
Query: 169 gagccgcaaaatttcaagtctgtagccgagattgaggacttcgagaagcggtttagacct 228
||||| ||||| || |||| || || ||||||||| || ||||||||||| || ||
Sbjct: 172 gagccacaaaactttaagtgtgcagaagagattgagatatttgagaagcggttcaggccg 231
Query: 229 atttcgattcagttgcaggac 249
|||| | |||||||||||||
Sbjct: 232 ctttccaatcagttgcaggac 252