Jatropha Genome Database
- JcCA0154191.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0154191.20 - phase: 0 /pseudo
(1869 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29709.m001216 sterol desaturase, putative 101 1e-20
29709.m001214 sterol desaturase, putative 94 4e-18
>29709.m001216 sterol desaturase, putative
Length = 1869
Score = 101 bits (51), Expect = 1e-20
Identities = 87/99 (87%)
Strand = Plus / Plus
Query: 445 cttcatcaccattacctctactctcgctaccattcgcatcaccattcctccatcgtcacc 504
|||||||| ||||| |||||||||||||| ||||| ||||||||||||||||| || ||
Sbjct: 439 cttcatcatcattatctctactctcgctatcattcccatcaccattcctccatagttaca 498
Query: 505 gagccaatcacctctgtgattcatccatttgcggaacac 543
||||| || || |||||||||||||| ||||| ||||||
Sbjct: 499 gagcccattacatctgtgattcatccttttgcagaacac 537
Score = 65.9 bits (33), Expect = 8e-10
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 1690 tgtgagaactggttgccaagaagagtgatgagcgcttggcgtatagcaggaatattacat 1749
|||||||| |||||||||||||| ||||||||||| ||||| |||||||||| | |||
Sbjct: 1687 tgtgagaattggttgccaagaagggtgatgagcgcatggcgggcagcaggaatagtgcat 1746
Query: 1750 gcattggagggatggaatgtg 1770
| |||| ||||||||||||
Sbjct: 1747 gggctggaaggatggaatgtg 1767
Score = 54.0 bits (27), Expect = 3e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 1276 aaggtggtggacggaagcagtctggcagtggctgttgtg 1314
||||||||||||||||||||||| ||||| || ||||||
Sbjct: 1276 aaggtggtggacggaagcagtctagcagtagcagttgtg 1314
>29709.m001214 sterol desaturase, putative
Length = 1854
Score = 93.7 bits (47), Expect = 4e-18
Identities = 110/131 (83%)
Strand = Plus / Plus
Query: 400 catgcgggtcctgtggagttcatctattattggcttcacagagcacttcatcaccattac 459
||||| |||||||||||||| | ||||| ||| | |||||||| ||||| |||||||||
Sbjct: 400 catgctggtcctgtggagtttctttattactggttacacagagctcttcaccaccattac 459
Query: 460 ctctactctcgctaccattcgcatcaccattcctccatcgtcaccgagccaatcacctct 519
||||| |||||||| || || |||||||||||||| || ||||| |||| || |||||
Sbjct: 460 ctctattctcgctatcactcccatcaccattcctctattgtcactcagcccatttcctct 519
Query: 520 gtgattcatcc 530
|| ||||||||
Sbjct: 520 gtaattcatcc 530
Score = 85.7 bits (43), Expect = 9e-16
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 637 attgacttgatgaacaacatgggtcactgcaactttgagctcattccagactcactcttc 696
||||| || ||||||||| |||| || |||||||||||| |||||||| | || || |||
Sbjct: 637 attgattttatgaacaacttgggacattgcaactttgagatcattccaaaatctctattc 696
Query: 697 tccgtctttccaccgctcaagtatcttatgtacactccgacatatcactccctccatcac 756
|| ||| ||| || || || || || ||||| ||||| ||| ||||| |||||||||
Sbjct: 697 tctttctgtcctcctcttaaatacctcatgtatactccctcattccactcactccatcac 756
Query: 757 acccaattccgtaccaattactcgcttttcatgcccctctacgactacgtgtatggtac 815
|||||||| || || ||||||||||| ||||||||| | || |||||| | ||||||||
Sbjct: 757 acccaatttcgaactaattactcgctcttcatgcccttttatgactacatctatggtac 815
Score = 58.0 bits (29), Expect = 2e-07
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 250 attgagttcgagcaagttgacagggaaagcaattgggatgaccag 294
||||||||||| ||||||||||| ||||| ||||||||||||||
Sbjct: 250 attgagttcgaccaagttgacagagaaagagattgggatgaccag 294