Jatropha Genome Database

JcCA0154191.20
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0154191.20 - phase: 0 /pseudo
         (1869 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29709.m001216 sterol desaturase, putative                             101   1e-20
29709.m001214 sterol desaturase, putative                              94   4e-18

>29709.m001216 sterol desaturase, putative
          Length = 1869

 Score =  101 bits (51), Expect = 1e-20
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 445 cttcatcaccattacctctactctcgctaccattcgcatcaccattcctccatcgtcacc 504
           |||||||| ||||| |||||||||||||| ||||| ||||||||||||||||| || || 
Sbjct: 439 cttcatcatcattatctctactctcgctatcattcccatcaccattcctccatagttaca 498

                                                  
Query: 505 gagccaatcacctctgtgattcatccatttgcggaacac 543
           ||||| || || |||||||||||||| ||||| ||||||
Sbjct: 499 gagcccattacatctgtgattcatccttttgcagaacac 537



 Score = 65.9 bits (33), Expect = 8e-10
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1690 tgtgagaactggttgccaagaagagtgatgagcgcttggcgtatagcaggaatattacat 1749
            |||||||| |||||||||||||| ||||||||||| |||||   |||||||||| | |||
Sbjct: 1687 tgtgagaattggttgccaagaagggtgatgagcgcatggcgggcagcaggaatagtgcat 1746

                                 
Query: 1750 gcattggagggatggaatgtg 1770
            |   |||| ||||||||||||
Sbjct: 1747 gggctggaaggatggaatgtg 1767



 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 1276 aaggtggtggacggaagcagtctggcagtggctgttgtg 1314
            ||||||||||||||||||||||| ||||| || ||||||
Sbjct: 1276 aaggtggtggacggaagcagtctagcagtagcagttgtg 1314


>29709.m001214 sterol desaturase, putative
          Length = 1854

 Score = 93.7 bits (47), Expect = 4e-18
 Identities = 110/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 400 catgcgggtcctgtggagttcatctattattggcttcacagagcacttcatcaccattac 459
           ||||| ||||||||||||||  | ||||| ||| | |||||||| ||||| |||||||||
Sbjct: 400 catgctggtcctgtggagtttctttattactggttacacagagctcttcaccaccattac 459

                                                                       
Query: 460 ctctactctcgctaccattcgcatcaccattcctccatcgtcaccgagccaatcacctct 519
           ||||| |||||||| || || |||||||||||||| || |||||  |||| ||  |||||
Sbjct: 460 ctctattctcgctatcactcccatcaccattcctctattgtcactcagcccatttcctct 519

                      
Query: 520 gtgattcatcc 530
           || ||||||||
Sbjct: 520 gtaattcatcc 530



 Score = 85.7 bits (43), Expect = 9e-16
 Identities = 145/179 (81%)
 Strand = Plus / Plus

                                                                       
Query: 637 attgacttgatgaacaacatgggtcactgcaactttgagctcattccagactcactcttc 696
           ||||| || ||||||||| |||| || |||||||||||| |||||||| | || || |||
Sbjct: 637 attgattttatgaacaacttgggacattgcaactttgagatcattccaaaatctctattc 696

                                                                       
Query: 697 tccgtctttccaccgctcaagtatcttatgtacactccgacatatcactccctccatcac 756
           ||  ||| ||| || || || || || ||||| |||||  |||  ||||| |||||||||
Sbjct: 697 tctttctgtcctcctcttaaatacctcatgtatactccctcattccactcactccatcac 756

                                                                      
Query: 757 acccaattccgtaccaattactcgcttttcatgcccctctacgactacgtgtatggtac 815
           |||||||| || || ||||||||||| ||||||||| | || |||||| | ||||||||
Sbjct: 757 acccaatttcgaactaattactcgctcttcatgcccttttatgactacatctatggtac 815



 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 250 attgagttcgagcaagttgacagggaaagcaattgggatgaccag 294
           ||||||||||| ||||||||||| |||||  ||||||||||||||
Sbjct: 250 attgagttcgaccaagttgacagagaaagagattgggatgaccag 294