Jatropha Genome Database
- JcCA0154181.30
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0154181.30 + phase: 0
(486 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29681.m001337 undecaprenyl pyrophosphate synthetase, putative 90 1e-17
>29681.m001337 undecaprenyl pyrophosphate synthetase, putative
Length = 933
Score = 89.7 bits (45), Expect = 1e-17
Identities = 120/145 (82%)
Strand = Plus / Plus
Query: 304 catgaggctggtggacggacattgacggatattgtgaagctttgctggcaatgggggatt 363
||||||||||| | ||| |||||| ||| ||| |||| ||||| | || |||||||||
Sbjct: 310 catgaggctggcgtacgctcattgatggagattatgaacctttgtggtcactgggggatt 369
Query: 364 aaagttcttactgtttttgcgttttcctgcgataattggacgaggccccaggtggaggtt 423
||||||||||| |||||||| ||||| || || |||||||| ||||| |||||||| |
Sbjct: 370 aaagttcttacagtttttgccttttcttgtgagaattggactaggcctaaggtggagatc 429
Query: 424 gatttcctgatgagtttgttcgaaa 448
|| ||| ||||||||||||| ||||
Sbjct: 430 gacttcttgatgagtttgtttgaaa 454