Jatropha Genome Database

JcCA0153601.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0153601.20 + phase: 0 
         (723 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28565.m000327 Programmed cell death 6-interacting protein, putative   111   6e-24

>28565.m000327 Programmed cell death 6-interacting protein, putative
          Length = 2052

 Score =  111 bits (56), Expect = 6e-24
 Identities = 92/104 (88%)
 Strand = Plus / Plus

                                                                       
Query: 577 atgttggagaggttgatgctggctcaagcgcaggagtgtgtgtttgagaataccattgct 636
           ||||||||||||||||||||||| ||||||||||| ||||| |||||||| || ||||||
Sbjct: 1   atgttggagaggttgatgctggcacaagcgcaggaatgtgtttttgagaacactattgct 60

                                                       
Query: 637 aaagggagtactccaggggtctgcgctaagattgcgaggcaggt 680
           ||||||||||| || || || || || |||||||| ||||||||
Sbjct: 61  aaagggagtacgcctggtgtttgtgccaagattgccaggcaggt 104