Jatropha Genome Database
- JcCA0153601.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0153601.20 + phase: 0
(723 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
28565.m000327 Programmed cell death 6-interacting protein, putative 111 6e-24
>28565.m000327 Programmed cell death 6-interacting protein, putative
Length = 2052
Score = 111 bits (56), Expect = 6e-24
Identities = 92/104 (88%)
Strand = Plus / Plus
Query: 577 atgttggagaggttgatgctggctcaagcgcaggagtgtgtgtttgagaataccattgct 636
||||||||||||||||||||||| ||||||||||| ||||| |||||||| || ||||||
Sbjct: 1 atgttggagaggttgatgctggcacaagcgcaggaatgtgtttttgagaacactattgct 60
Query: 637 aaagggagtactccaggggtctgcgctaagattgcgaggcaggt 680
||||||||||| || || || || || |||||||| ||||||||
Sbjct: 61 aaagggagtacgcctggtgtttgtgccaagattgccaggcaggt 104