Jatropha Genome Database

JcCA0153521.40
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0153521.40 + phase: 0 /partial
         (448 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29929.m004749 r2r3-myb transcription factor, putative                 383   e-106
29633.m000891 r2r3-myb transcription factor, putative                  96   2e-19
28154.m000040 r2r3-myb transcription factor, putative                  86   2e-16
30147.m013885 r2r3-myb transcription factor, putative                  72   3e-12
29005.m000265 r2r3-myb transcription factor, putative                  70   1e-11
30225.m001683 r2r3-myb transcription factor, putative                  66   2e-10
29680.m001686 r2r3-myb transcription factor, putative                  62   3e-09
29889.m003258 r2r3-myb transcription factor, putative                  60   1e-08
30076.m004682 r2r3-myb transcription factor, putative                  58   5e-08
28271.m000023 DNA binding protein, putative                            58   5e-08

>29929.m004749 r2r3-myb transcription factor, putative
          Length = 441

 Score =  383 bits (193), Expect = e-106
 Identities = 331/377 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagacaaccttgttgtgacaaaattggattgaagagaggtccatggactatcgaa 60
           ||||||||||| ||||||||||| ||  |||||||||||||||||||||||||||| |||
Sbjct: 1   atgggaagacagccttgttgtgataaggttggattgaagagaggtccatggactattgaa 60

                                                                       
Query: 61  gaagaccaaaagcttatgaacttcattctcaacaatggaatccaatgttggagacttgtc 120
           ||||| || ||||| ||||| ||||| ||||||||||| || || || ||| |||| || 
Sbjct: 61  gaagatcataagctcatgaatttcatcctcaacaatgggattcagtgctggcgactggtt 120

                                                                       
Query: 121 ccaaaacttgcaggtttattaaggtgtgggaagagttgcagattgagatggatgaattac 180
           || ||||||||||| |||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 121 ccgaaacttgcagggttattaagatgtggaaagagctgcagattgagatggatgaattac 180

                                                                       
Query: 181 ttgaggcctgatcttaaaagaggagctttaacagaatcagaagaagatcaaataatcgaa 240
            |||| |||||| | || |||||||| ||||||||| | |||||||||||||| ||||||
Sbjct: 181 ctgagacctgatttgaagagaggagcattaacagaagctgaagaagatcaaatcatcgaa 240

                                                                       
Query: 241 ctccattcgcgtttgggtaacaggtggtctaaaattgctgcacattttccaggccgtaca 300
           ||||||||||||||||| |||| |||||| || ||||||||||||||||||||| | |||
Sbjct: 241 ctccattcgcgtttgggaaacaagtggtcaaagattgctgcacattttccaggcagaaca 300

                                                                       
Query: 301 gataatgaaataaagaaccattggaatataagaattaagaagaaactaaagattcttggt 360
           |||||||| || || ||||||||||||| |||||| |||||||||||||||| ||| |||
Sbjct: 301 gataatgagattaaaaaccattggaatacaagaatcaagaagaaactaaagactctgggt 360

                            
Query: 361 atagacccacaaaccca 377
            ||||||| ||||||||
Sbjct: 361 gtagaccctcaaaccca 377


>29633.m000891 r2r3-myb transcription factor, putative
          Length = 729

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagacaaccttgttgtgacaaaattggattgaagagaggtccatggactatcgaa 60
           |||||||| |||||||| ||||| || |||||  | |||||||||||||||||||| |||
Sbjct: 1   atgggaaggcaaccttgctgtgataagattggtctcaagagaggtccatggactattgaa 60

                                                                       
Query: 61  gaagaccaaaagcttatgaacttcattctcaacaatggaatccaatgttggagacttgtc 120
           ||||| || ||||| |||||||| || || || ||||| || || || ||| || | || 
Sbjct: 61  gaagatcacaagctcatgaactttatccttaataatggtattcattgctggcgaatggtt 120

                                                                       
Query: 121 ccaaaacttgcaggtttattaaggtgtgggaagagttgcagattgagatggatgaattac 180
           || || ||||||||| |  || | ||||| ||||| || ||| || ||||||| ||||| 
Sbjct: 121 cctaagcttgcaggtctgctacgatgtggaaagagctgtagactgcgatggattaattat 180

                                               
Query: 181 ttgaggcctgatcttaaaagaggagctttaacagaa 216
            |||||||||||||||| ||||| | ||| ||||||
Sbjct: 181 ctgaggcctgatcttaagagaggtggtttcacagaa 216


>28154.m000040 r2r3-myb transcription factor, putative
          Length = 906

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 55/59 (93%)
 Strand = Plus / Plus

                                                                      
Query: 145 tgtgggaagagttgcagattgagatggatgaattacttgaggcctgatcttaaaagagg 203
           ||||| |||||||||||| | |||||||| |||||||||||||||||||||||||||||
Sbjct: 145 tgtggcaagagttgcagactcagatggataaattacttgaggcctgatcttaaaagagg 203


>30147.m013885 r2r3-myb transcription factor, putative
          Length = 1137

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 141 aaggtgtgggaagagttgcagattgagatggatgaattacttgaggcctgatcttaaaag 200
           ||||||||| ||||||||||||||||||||||| || ||||| || ||||| ||||| ||
Sbjct: 141 aaggtgtggaaagagttgcagattgagatggattaactacttaagacctgaccttaagag 200

               
Query: 201 agga 204
           ||||
Sbjct: 201 agga 204


>29005.m000265 r2r3-myb transcription factor, putative
          Length = 297

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 141/175 (80%), Gaps = 6/175 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagacaaccttgttgtgacaaaattggattgaagagaggtccatggactatcgaa 60
           |||||||||||||| |||||||||||| |||| ||||||| ||| ||||||||    |||
Sbjct: 1   atgggaagacaaccatgttgtgacaaagttggtttgaagaaagggccatggacagctgaa 60

                                                                       
Query: 61  gaagaccaaaagcttatgaacttcattctcaacaatggaatccaatgt---tggagactt 117
           |||||  | || ||||| ||||| || || | ||||||   |||||||   ||||||  |
Sbjct: 61  gaagataagaaacttatcaactttatccttaccaatgg---ccaatgttgctggagagct 117

                                                                  
Query: 118 gtcccaaaacttgcaggtttattaaggtgtgggaagagttgcagattgagatgga 172
           || || || |||||||| || ||||||||||| |||||||||||  |||||||||
Sbjct: 118 gttcctaagcttgcaggattgttaaggtgtggaaagagttgcaggctgagatgga 172


>30225.m001683 r2r3-myb transcription factor, putative
          Length = 657

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 119 tcccaaaacttgcaggtttattaaggtgtgggaagagttgcagattgagatggatgaatt 178
           |||| ||| |||||||| ||| |||||| |||||||||||||||||| ||||| ||||||
Sbjct: 119 tccctaaatttgcaggtctatcaaggtgcgggaagagttgcagattgcgatggttgaatt 178

            
Query: 179 a 179
           |
Sbjct: 179 a 179


>29680.m001686 r2r3-myb transcription factor, putative
          Length = 543

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 gcaggtttattaaggtgtgggaagagttgcagattgagatggatgaattacttgaggcct 189
           |||||| ||||||||||||| |||||||||||  | |||||||| || ||| ||||||| 
Sbjct: 130 gcaggtatattaaggtgtggaaagagttgcaggcttagatggataaactacctgaggcca 189

                          
Query: 190 gatcttaaaagagga 204
           ||| ||||| |||||
Sbjct: 190 gatattaaacgagga 204


>29889.m003258 r2r3-myb transcription factor, putative
          Length = 996

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 129 tgcaggtttattaaggtgtgggaagagttgcagattgagatggatgaattactt 182
           |||||| || ||||||||||| |||||||||||| |||||||||| || |||||
Sbjct: 129 tgcaggattgttaaggtgtggcaagagttgcagactgagatggattaactactt 182


>30076.m004682 r2r3-myb transcription factor, putative
          Length = 282

 Score = 58.0 bits (29), Expect = 5e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 129 tgcaggtttattaaggtgtgggaagagttgcagattgagatggat 173
           |||||| ||||| ||||||||||| ||||||||| ||||||||||
Sbjct: 129 tgcaggattattgaggtgtgggaaaagttgcagactgagatggat 173


>28271.m000023 DNA binding protein, putative
          Length = 781

 Score = 58.0 bits (29), Expect = 5e-08
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 253 ttgggtaacaggtggtctaaaattgctgcacattttccaggccgtacagataatgaaata 312
           ||||||||||||||||| ||||||||    ||||| |||||  | |||||||||||||| 
Sbjct: 295 ttgggtaacaggtggtcgaaaattgcacagcatttaccaggaagaacagataatgaaatc 354

                        
Query: 313 aagaaccattgga 325
           |||||| ||||||
Sbjct: 355 aagaactattgga 367