Jatropha Genome Database

JcCA0150831.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0150831.20 + phase: 0 /pseudo/partial/short
         (146 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30140.m000572 conserved hypothetical protein                           54   2e-07

>30140.m000572 conserved hypothetical protein
          Length = 582

 Score = 54.0 bits (27), Expect = 2e-07
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  atccacctgttgccaatgatattttccagtgcatgaatcacgggcgatccaccattgctg 73
           ||||||||||||| ||||| || ||  | |||||||||   |||||||| |  || ||||
Sbjct: 302 atccacctgttgcaaatgaaatatttgattgcatgaattgtgggcgatcaataatggctg 361

                                                  
Query: 74  gaaggtttgccccttattcagaaaagtgcatgggaaagg 112
           |||| ||||| ||| |||  |||||||||||||||||||
Sbjct: 362 gaagatttgctcctcatttggaaaagtgcatgggaaagg 400