Jatropha Genome Database

JcCA0150341.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0150341.10 + phase: 0 /partial
         (336 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29830.m001423 Adipocyte plasma membrane-associated protein, puta...    70   9e-12
29830.m001424 Adipocyte plasma membrane-associated protein, puta...    56   1e-07

>29830.m001423 Adipocyte plasma membrane-associated protein,
           putative
          Length = 939

 Score = 69.9 bits (35), Expect = 9e-12
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 13  atccattatgatggacatggccacttctggattgc 47
           |||||||||||||||||||||||||||||||||||
Sbjct: 823 atccattatgatggacatggccacttctggattgc 857


>29830.m001424 Adipocyte plasma membrane-associated protein,
           putative
          Length = 1143

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 16  cattatgatggacatggccacttctggattgcatta 51
           |||| |||||||||||||||||| ||||||||||||
Sbjct: 841 cattctgatggacatggccacttttggattgcatta 876