Jatropha Genome Database

JcCA0149441.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0149441.20 - phase: 0 /partial
         (243 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014113 conserved hypothetical protein                          139   8e-33

>30147.m014113 conserved hypothetical protein
          Length = 945

 Score =  139 bits (70), Expect = 8e-33
 Identities = 196/238 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   tatgatgctgctattctccatacatcctttgctaggcttctgggtcatcccaaagcttca 60
           ||||||||||||||||| || || |||||||| ||||||||||| || ||||||| ||||
Sbjct: 700 tatgatgctgctattcttcacacgtcctttgcaaggcttctgggccaccccaaagattca 759

                                                                       
Query: 61  cacttggaggcttcaaatgaactccagtttttccacgaactagttgctcgtctaaacaat 120
           | |   ||| ||||| | |||||||   ||||||| || |||||||| || |||||||||
Sbjct: 760 cccgcagagccttcagaagaactccgacttttccatgagctagttgcacgcctaaacaat 819

                                                                       
Query: 121 agaataaagggatctgaggcagttatttcagagctctggtatgtggaggaatatgatgta 180
             |||    |||| || ||||||| | || || |||||||||||||||||||||||||| 
Sbjct: 820 caaattcgtggatttgtggcagttgtatctgaactctggtatgtggaggaatatgatgtc 879

                                                                     
Query: 181 ctggctcttgcattgaatggaagaatgaacatccgcaagttccaacttggctgcaaaa 238
            |||| ||||||||| |||||||||||||  |||| |||||||| || ||||||||||
Sbjct: 880 ttggcacttgcattggatggaagaatgaaggtccggaagttccagctcggctgcaaaa 937