Jatropha Genome Database

JcCA0149021.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0149021.10 - phase: 0 
         (762 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29726.m004094 conserved hypothetical protein                          135   4e-31
29801.m003186 hypothetical protein                                     64   1e-09
30128.m008556 AP2 domain transcription factor RAP2.3, putative         56   3e-07
29863.m001066 conserved hypothetical protein                           54   1e-06

>29726.m004094 conserved hypothetical protein
          Length = 744

 Score =  135 bits (68), Expect = 4e-31
 Identities = 152/180 (84%)
 Strand = Plus / Plus

                                                                       
Query: 268 cgaaagaatatttacaggggaataaggcgaaggccatggggaaaatgggcggctgaaatc 327
           ||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| || 
Sbjct: 265 cgaaagaatatttacagaggaataaggcaaaggccatggggaaaatgggcagctgagatt 324

                                                                       
Query: 328 agagacccgcacaagggcgtacgtgtttggcttggtacttacaacacagctgaagaagcc 387
           |||||||| || || || ||  | || ||||| ||||| | || ||| ||||||||||| 
Sbjct: 325 agagacccacaaaaaggagttagagtatggctaggtaccttcagcactgctgaagaagct 384

                                                                       
Query: 388 gctcgagcctacgatgaagctgccaagcgtatccgtggtgaaaaagccaagcttaatttt 447
           ||||| ||||| ||||| || |||||||| ||||||||||| || || ||||| ||||||
Sbjct: 385 gctcgtgcctatgatgaggcagccaagcgcatccgtggtgacaaggctaagctcaatttt 444


>29801.m003186 hypothetical protein
          Length = 867

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 269 gaaagaatatttacaggggaataaggcgaaggccatggggaaaatgggcggc 320
           ||||||| | |||||| ||| |||||| ||||||||||||||||||||||||
Sbjct: 425 gaaagaagaattacagaggagtaaggcaaaggccatggggaaaatgggcggc 476


>30128.m008556 AP2 domain transcription factor RAP2.3, putative
          Length = 750

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 283 aggggaataaggcgaaggccatggggaaaatgggcggctgaaat 326
           |||||| |||| | ||||||||||||||||||||| ||||||||
Sbjct: 172 aggggagtaagacaaaggccatggggaaaatgggcagctgaaat 215


>29863.m001066 conserved hypothetical protein
          Length = 1347

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 352 gtttggcttggtacttacaacacagctgaagaagccgctcgagcctacgatgaagctgc 410
           |||||||||||||| | | ||||||| |||| ||| || ||||| ||||||||||||||
Sbjct: 739 gtttggcttggtacattcgacacagcagaagcagctgcacgagcatacgatgaagctgc 797