Jatropha Genome Database
- JcCA0148631.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0148631.20 - phase: 2 /partial
(328 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30147.m013950 conserved hypothetical protein 210 4e-54
>30147.m013950 conserved hypothetical protein
Length = 1608
Score = 210 bits (106), Expect = 4e-54
Identities = 259/310 (83%)
Strand = Plus / Plus
Query: 1 agagattgaaaatgaagatgaactcaagactggaccttacagtgcacgaactaatgagca 60
|||||||||||| ||||||||| ||||| |||||||||| || ||| || |||||||||
Sbjct: 1278 agagattgaaaacgaagatgaagtcaaggctggaccttatggtacacaaagtaatgagca 1337
Query: 61 gccaattcagcgtgcatgggttcctccacagccaccgcctgttgcaatgcctgaagcagc 120
||| ||| |||||||||||| ||||| |||||||| |||||||| ||| ||||||||||
Sbjct: 1338 accagttcggcgtgcatgggtccctccccagccaccccctgttgctatggctgaagcagc 1397
Query: 121 agaagccattcgacggccaaaaccatcagttcagaaggaacagttggctgatgatcagcc 180
||||||||| |||||||||||||||||||||||||||||||| | || || || ||| |
Sbjct: 1398 agaagccatccgacggccaaaaccatcagttcagaaggaacaatcgggagaggagcagtc 1457
Query: 181 tgtgtctcattccacagacgcaacggatgagttgcagaggataacaaaaatatctgaatc 240
|||| | ||||| ||||| ||||| ||||||| ||||||||||||| |||||||
Sbjct: 1458 caaatctcttcaaacagatgcaacagatgaattgcagaagataacaaaaatagctgaatc 1517
Query: 241 aggtggtgcagtggagatcaacggtggggaatcagaggtaaactcaagcgagataaagga 300
|| |||| ||| ||||| | ||||| ||||||| ||||||||| |||||||||||
Sbjct: 1518 tggaggtggcatgggaatcaatgatgggggatcagagctaaactcaaatgagataaagga 1577
Query: 301 agatcaagaa 310
||| ||||||
Sbjct: 1578 agagcaagaa 1587