Jatropha Genome Database

JcCA0147181.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0147181.10 + phase: 0 
         (1227 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m008955 conserved hypothetical protein                           62   8e-09

>30174.m008955 conserved hypothetical protein
          Length = 1368

 Score = 61.9 bits (31), Expect = 8e-09
 Identities = 109/135 (80%)
 Strand = Plus / Plus

                                                                       
Query: 514 agcagtaatgggtcgagctggtgtgacagtgatttcacatcagagtatttacctttctgg 573
           |||||||| |||||||||||||| ||||||||||| ||  | || |||||||| | ||||
Sbjct: 580 agcagtaacgggtcgagctggtgcgacagtgattttactgcggaatatttaccatgctgg 639

                                                                       
Query: 574 aacggtaattctgaggagtatggtgaaaacgaggcaatggaagtgggtaaaaaagattta 633
            ||||| | |||||  | |   | ||||||||||   |  |||||||||||||| |||||
Sbjct: 640 cacggtgaatctgaaaaattctgcgaaaacgaggaggttaaagtgggtaaaaaacattta 699

                          
Query: 634 ccatgtgtcggcgag 648
           ||| |||||||||||
Sbjct: 700 ccacgtgtcggcgag 714