Jatropha Genome Database

JcCA0147021.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0147021.10 - phase: 0 /partial
         (588 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27766.m000157 STS14 protein precursor, putative                       180   6e-45
27766.m000158 STS14 protein precursor, putative                        62   4e-09

>27766.m000157 STS14 protein precursor, putative
          Length = 597

 Score =  180 bits (91), Expect = 6e-45
 Identities = 226/271 (83%)
 Strand = Plus / Plus

                                                                       
Query: 310 tttccagaaggggacttcaagttaggagaaaatatatattggggcagtgggaacacgtgg 369
           ||||||||||| || |||||| | || || || ||||| ||||| ||||| |   | |||
Sbjct: 316 tttccagaaggtgatttcaagctgggggagaacatatactggggaagtggcacagcctgg 375

                                                                       
Query: 370 acaccacgtgatgctgttagtgcatgggctagtgaagaaaaatactatagttacgaaaca 429
           || ||| | |||||||| ||||||||||| ||||| || || |||||||  |||| ||||
Sbjct: 376 acgccaagggatgctgtcagtgcatgggcgagtgaggagaagtactatacctacgcaaca 435

                                                                       
Query: 430 aatagttgtgttgaaggagaaatgtgtgggcattatacacagattgtttggaaaagtact 489
           ||    ||||  || ||| |||||||||| || |||||||||||||| ||||| |  || 
Sbjct: 436 aactcatgtgaagagggacaaatgtgtggccactatacacagattgtgtggaagacgaca 495

                                                                       
Query: 490 aggagaattggctgtgctagagttgtttgtgatgatggagatgtgtttatgacttgtaat 549
           ||||||||||| |||||| | |||||||||||||||||||||||||||||||| ||||||
Sbjct: 496 aggagaattgggtgtgctcgtgttgtttgtgatgatggagatgtgtttatgacatgtaat 555

                                          
Query: 550 tatgatcctcctggtaattatattggtgaaa 580
           |||||||||||||||||||||||||| ||||
Sbjct: 556 tatgatcctcctggtaattatattggggaaa 586


>27766.m000158 STS14 protein precursor, putative
          Length = 540

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 538 atgacttgtaattatgatcctcctggtaattatattggtgaaaggcc 584
           |||||||| |||||||||||||||||||| || ||||| ||||||||
Sbjct: 487 atgacttgcaattatgatcctcctggtaactacattggagaaaggcc 533