Jatropha Genome Database

JcCA0146861.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0146861.10 - phase: 0 
         (1101 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m009047 zinc finger protein, putative                           236   2e-61
30174.m009048 conserved hypothetical protein                           70   3e-11

>30174.m009047 zinc finger protein, putative
          Length = 534

 Score =  236 bits (119), Expect = 2e-61
 Identities = 380/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 71  cagcaccctgcacgctctactgccatgccgactcagcttacctatgtaacaattgtgatg 130
           ||||||||||||| |||||||||||| | |||||||| ||||| ||| | ||||||||||
Sbjct: 47  cagcaccctgcacactctactgccatactgactcagcctacctctgtcaaaattgtgatg 106

                                                                       
Query: 131 agtatgtccatgcagcaaattccttagctttgaagcataagcgtgtttgggtttgcactg 190
           | | | | |||||| ||||| |||| |||||| ||||| | ||||| ||| |||||| ||
Sbjct: 107 aatttattcatgcaacaaatcccttggctttgcagcatgaccgtgtctggatttgcattg 166

                                                                       
Query: 191 catgtgaaaatgctccagcagcttttacctgtcaacccgatgcagcaaaattatgcatca 250
           | |||||||||||||||||| ||||||| |||||  | ||||| |||||  |||||||||
Sbjct: 167 cttgtgaaaatgctccagcaacttttacttgtcaggctgatgctgcaaacctatgcatca 226

                                                                       
Query: 251 actgtgatattgaaatacactcagcgaatccattggcgggccgacatatcagggttccaa 310
           ||||||| |  ||||| ||||  || ||||||||| || |||| |||| ||| || ||||
Sbjct: 227 actgtgacaccgaaattcacttggccaatccattgccgtgccgccataacagagtcccaa 286

                                                                       
Query: 311 taactcctatatctggtttggcgaacacatcgtcaactacttgcctggaagaatcgcaag 370
           || |||||    ||||| | | |  ||| || |||||||||| ||||||  | ||||| |
Sbjct: 287 tatctcctccccctggtatagtgcccacttcctcaactacttacctggacaagtcgcagg 346

                                                                       
Query: 371 cacctttgctacacacagaaaatgatgctatggctaacaagattgtacatgaattagaag 430
             ||  ||| | ||||||||||||| || ||||| ||||||| | || | ||||||||| 
Sbjct: 347 tccccctgcgagacacagaaaatgaagccatggccaacaagagtatagaggaattagaac 406

                                                                       
Query: 431 aagatcaaacagattcttggttactgcttgatcttgataataatgacaaccagactaata 490
           ||||| || ||||||||||||| |||||||||||||||||||||||| |||||| | |||
Sbjct: 407 aagatgaagcagattcttggttgctgcttgatcttgataataatgacgaccagagtgata 466

                                                          
Query: 491 caggatttacttacattgaggatgttgaccagtatttgaatcacatt 537
             |||||| |||||| ||||||||||||  |||||||| ||| ||||
Sbjct: 467 gtggatttccttacagtgaggatgttgatgagtatttggatctcatt 513


>30174.m009048 conserved hypothetical protein
          Length = 378

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 93/111 (83%), Gaps = 1/111 (0%)
 Strand = Plus / Plus

                                                                       
Query: 581 atcagcagcaactttca-agtgctcatcggggagatatttgtggtgatagcattgtccca 639
           ||||||||||||||||  || | ||||| |||||||| | |  |||||||  ||||||||
Sbjct: 4   atcagcagcaactttcttagcgttcatcagggagataatggcagtgatagtgttgtccca 63

                                                              
Query: 640 gttcaatcttttgaagcacaggatcaacaagaacaccatcaccagcagcag 690
           ||||||||  ||||| || ||||||||| ||| ||||| ||||||||||||
Sbjct: 64  gttcaatcccttgaatcaaaggatcaacgagaccaccaccaccagcagcag 114