Jatropha Genome Database
- JcCA0146861.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0146861.10 - phase: 0
(1101 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30174.m009047 zinc finger protein, putative 236 2e-61
30174.m009048 conserved hypothetical protein 70 3e-11
>30174.m009047 zinc finger protein, putative
Length = 534
Score = 236 bits (119), Expect = 2e-61
Identities = 380/467 (81%)
Strand = Plus / Plus
Query: 71 cagcaccctgcacgctctactgccatgccgactcagcttacctatgtaacaattgtgatg 130
||||||||||||| |||||||||||| | |||||||| ||||| ||| | ||||||||||
Sbjct: 47 cagcaccctgcacactctactgccatactgactcagcctacctctgtcaaaattgtgatg 106
Query: 131 agtatgtccatgcagcaaattccttagctttgaagcataagcgtgtttgggtttgcactg 190
| | | | |||||| ||||| |||| |||||| ||||| | ||||| ||| |||||| ||
Sbjct: 107 aatttattcatgcaacaaatcccttggctttgcagcatgaccgtgtctggatttgcattg 166
Query: 191 catgtgaaaatgctccagcagcttttacctgtcaacccgatgcagcaaaattatgcatca 250
| |||||||||||||||||| ||||||| ||||| | ||||| ||||| |||||||||
Sbjct: 167 cttgtgaaaatgctccagcaacttttacttgtcaggctgatgctgcaaacctatgcatca 226
Query: 251 actgtgatattgaaatacactcagcgaatccattggcgggccgacatatcagggttccaa 310
||||||| | ||||| |||| || ||||||||| || |||| |||| ||| || ||||
Sbjct: 227 actgtgacaccgaaattcacttggccaatccattgccgtgccgccataacagagtcccaa 286
Query: 311 taactcctatatctggtttggcgaacacatcgtcaactacttgcctggaagaatcgcaag 370
|| ||||| ||||| | | | ||| || |||||||||| |||||| | ||||| |
Sbjct: 287 tatctcctccccctggtatagtgcccacttcctcaactacttacctggacaagtcgcagg 346
Query: 371 cacctttgctacacacagaaaatgatgctatggctaacaagattgtacatgaattagaag 430
|| ||| | ||||||||||||| || ||||| ||||||| | || | |||||||||
Sbjct: 347 tccccctgcgagacacagaaaatgaagccatggccaacaagagtatagaggaattagaac 406
Query: 431 aagatcaaacagattcttggttactgcttgatcttgataataatgacaaccagactaata 490
||||| || ||||||||||||| |||||||||||||||||||||||| |||||| | |||
Sbjct: 407 aagatgaagcagattcttggttgctgcttgatcttgataataatgacgaccagagtgata 466
Query: 491 caggatttacttacattgaggatgttgaccagtatttgaatcacatt 537
|||||| |||||| |||||||||||| |||||||| ||| ||||
Sbjct: 467 gtggatttccttacagtgaggatgttgatgagtatttggatctcatt 513
>30174.m009048 conserved hypothetical protein
Length = 378
Score = 69.9 bits (35), Expect = 3e-11
Identities = 93/111 (83%), Gaps = 1/111 (0%)
Strand = Plus / Plus
Query: 581 atcagcagcaactttca-agtgctcatcggggagatatttgtggtgatagcattgtccca 639
|||||||||||||||| || | ||||| |||||||| | | ||||||| ||||||||
Sbjct: 4 atcagcagcaactttcttagcgttcatcagggagataatggcagtgatagtgttgtccca 63
Query: 640 gttcaatcttttgaagcacaggatcaacaagaacaccatcaccagcagcag 690
|||||||| ||||| || ||||||||| ||| ||||| ||||||||||||
Sbjct: 64 gttcaatcccttgaatcaaaggatcaacgagaccaccaccaccagcagcag 114