Jatropha Genome Database

JcCA0146401.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0146401.20 + phase: 0 
         (582 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29726.m004095 conserved hypothetical protein                          109   2e-23

>29726.m004095 conserved hypothetical protein
          Length = 546

 Score =  109 bits (55), Expect = 2e-23
 Identities = 135/161 (83%), Gaps = 3/161 (1%)
 Strand = Plus / Plus

                                                                       
Query: 346 ggtagagggtggaatttcgatagatttggaggccaaaattgggacgagtcatcat---gg 402
           ||||||||||||||||| |||| ||||||||| || |||||||| || || || |   ||
Sbjct: 331 ggtagagggtggaattttgataaatttggagggcataattgggatgaatcctcgtcctgg 390

                                                                       
Query: 403 tcatcgtcttcaaggtttgcttatggattcgtttatgaagtgatttattggattgccctg 462
           || |||||||| | |||||| |||||||| ||||||||||||||||||||||||||  | 
Sbjct: 391 tcgtcgtcttctaagtttgcatatggatttgtttatgaagtgatttattggattgcgtta 450

                                                    
Query: 463 tcgacttgcatgcattttgcgttcgagaaggctgtgaggat 503
           |||| |||| |||||||||| || || |||| || ||||||
Sbjct: 451 tcgaattgcttgcattttgcatttgaaaaggttgcgaggat 491