Jatropha Genome Database

JcCA0142811.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0142811.10 + phase: 0 /partial
         (498 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29790.m000814 mads box protein, putative                              204   4e-52

>29790.m000814 mads box protein, putative
          Length = 567

 Score =  204 bits (103), Expect = 4e-52
 Identities = 211/247 (85%)
 Strand = Plus / Plus

                                                                       
Query: 86  tggaatgccccaagctcaaggctagaattgggatcttggagagaagcctaaggaaccttg 145
           |||||| ||| ||||||  |||||| |||| |||||| || ||||||||||||||| |||
Sbjct: 92  tggaataccctaagctcgtggctaggattgagatcttagaaagaagcctaaggaactttg 151

                                                                       
Query: 146 caggagaagatttggattccatgactctaagagagcttcaacacttagagcaccagattg 205
           ||||| ||||||||| | | |||| |||||||||||| |||||||||||||| |||||||
Sbjct: 152 caggaaaagatttgggtccgatgagtctaagagagctccaacacttagagcaacagattg 211

                                                                       
Query: 206 ataatgcacttaagcgtgtacgatcaagaaagaaccaactctatcatgattcccttttag 265
           ||| ||| |||||||| || ||||||||||||||||||||||||||||| || |||  ||
Sbjct: 212 atactgctcttaagcgcgtgcgatcaagaaagaaccaactctatcatgaatctcttgcag 271

                                                                       
Query: 266 agctgcagaagcaggaaagatcgttgcatgaccaaaacaacttgctaagcaaacagctgg 325
             ||||||||| | |||||||| |||||||| || |||||| |||||  |||||||||  
Sbjct: 272 ccctgcagaagaacgaaagatcattgcatgagcagaacaacatgctagccaaacagctca 331

                  
Query: 326 aggaaaa 332
           |||||||
Sbjct: 332 aggaaaa 338