Jatropha Genome Database

JcCA0142421.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0142421.20 + phase: 1 /partial
         (1085 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29687.m000598 Anthranilate N-benzoyltransferase protein, putative      64   2e-09

>29687.m000598 Anthranilate N-benzoyltransferase protein, putative
          Length = 1215

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 534 aagtacagtagttatgaaattctaactgcacatatatggcgttgcacatgca 585
           |||||||| || |||||||| || ||||||||||||||||| ||||||||||
Sbjct: 664 aagtacagcagctatgaaatcctgactgcacatatatggcgctgcacatgca 715