Jatropha Genome Database

JcCA0142191.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0142191.20 - phase: 0 /pseudo/partial
         (327 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

58512.m000009 conserved hypothetical protein                           64   5e-10
29678.m000504 alcohol dehydrogenase, putative                          62   2e-09
29678.m000499 alcohol dehydrogenase, putative                          60   8e-09

>58512.m000009 conserved hypothetical protein
          Length = 153

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 85  taaggttgatttgttgaagaacaagtttggattcgacgaggctttcaattacaatgaaga 144
           |||||||||| |||||||||||||||| || ||||| || |||||||| ||||| |||||
Sbjct: 21  taaggttgatatgttgaagaacaagttcgggttcgatgacgctttcaactacaaggaaga 80


>29678.m000504 alcohol dehydrogenase, putative
          Length = 1038

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 86  aaggttgatttgttgaagaacaagtttggattcgacgaggctttcaattacaatgaaga 144
           ||||||||| |||||||||||||||| || ||||| || |||||||| ||||| |||||
Sbjct: 574 aaggttgatatgttgaagaacaagttcgggttcgatgacgctttcaactacaaggaaga 632


>29678.m000499 alcohol dehydrogenase, putative
          Length = 1107

 Score = 60.0 bits (30), Expect = 8e-09
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  aaggttgatttgttgaagaacaagtttggattcgacgaggctttcaattacaatgaagaa 145
           ||||||||||||||||||||||| || || || || || |||||||||||||  ||||| 
Sbjct: 643 aaggttgatttgttgaagaacaaattcgggtttgatgaagctttcaattacagagaagag 702

                             
Query: 146 caggacttggatgcagct 163
           || |||| | ||||||||
Sbjct: 703 catgactggaatgcagct 720