Jatropha Genome Database

JcCA0142031.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0142031.20 + phase: 0 
         (510 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m009019 conserved hypothetical protein                           80   1e-14

>30174.m009019 conserved hypothetical protein
          Length = 528

 Score = 79.8 bits (40), Expect = 1e-14
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 88  gaagaagaggaagtagaagcggaagagttggaaagattggagtcagaagcgaaagaaatg 147
           |||||||| ||||| |||| |||||| |||||||  |||||| | |||||||||||||||
Sbjct: 109 gaagaagaagaagtggaagaggaagaattggaaaagttggagactgaagcgaaagaaatg 168

                                                       
Query: 148 gcgaagaagattctcgaatacagatccacttttccgaatcagct 191
           || | || |||||| ||||||||| ||||| ||||  |||||||
Sbjct: 169 gctacgaggattctagaatacagagccactcttccagatcagct 212