Jatropha Genome Database

JcCA0139601.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0139601.10 - phase: 0 
         (186 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013818 mads box protein, putative                               96   8e-20
30174.m008934 mads box protein, putative                               94   3e-19
29908.m005982 mads box protein, putative                               52   1e-06

>30170.m013818 mads box protein, putative
          Length = 864

 Score = 95.6 bits (48), Expect = 8e-20
 Identities = 54/56 (96%)
 Strand = Plus / Plus

                                                                  
Query: 1  atgggaagaggaaagatcgagatcaagaggatagagaacacaacgaatcgtcaagt 56
          ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 1  atgggaagaggaaagatcgagatcaagaggatagagaacacgacgaatcgccaagt 56


>30174.m008934 mads box protein, putative
          Length = 735

 Score = 93.7 bits (47), Expect = 3e-19
 Identities = 110/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 25  aagaggatagagaacacaacgaatcgtcaagtgaccttttgcaagaggagaaatggactg 84
           ||||||||||| |||| ||  ||||| ||||||||||| |  || ||||| |||||| ||
Sbjct: 25  aagaggatagaaaacaaaatcaatcgccaagtgaccttctctaaaaggaggaatggattg 84

                                                                       
Query: 85  ttgaagaaagcttatgaattgtcagtcctttgcgatgctgaggttgccctcattgtcttc 144
           ||||| |||||||||||  |||| || ||||| |||||||||||||| || ||| |||||
Sbjct: 85  ttgaaaaaagcttatgagctgtctgtgctttgtgatgctgaggttgctcttattatcttc 144

                      
Query: 145 tccagccgtgg 155
           ||||| |||||
Sbjct: 145 tccagtcgtgg 155


>29908.m005982 mads box protein, putative
          Length = 1044

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                       
Query: 19  gagatcaagaggatagagaacacaacgaatcgtcaagtgaccttttgcaagaggagaaat 78
           ||||| ||||| ||||||||||| || ||||| ||||| || ||||  ||  | ||||||
Sbjct: 19  gagataaagagaatagagaacactacaaatcgacaagttacattttcaaaacgtagaaat 78

                                                     
Query: 79  ggactgttgaagaaagcttatgaattgtcagtcctttgcgat 120
           |||||  | ||||||||||||||| | ||  |||||||||||
Sbjct: 79  ggactcattaagaaagcttatgaactttctatcctttgcgat 120