Jatropha Genome Database

JcCA0139141.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0139141.10 - phase: 0 
         (1092 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014288 s-adenosyl-l-methionine:delta24-sterol-C-methyltra...    64   2e-09

>30170.m014288
           s-adenosyl-l-methionine:delta24-sterol-C-
           methyltransferase, putative
          Length = 1086

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 730 gagataattcaagggattgagagaggagatgcattgcctggattaagaagttatagtgac 789
           ||||| ||||||||||| || ||||||||||| ||||||||| ||||||  || |  |||
Sbjct: 730 gagatcattcaagggatcgaaagaggagatgcgttgcctggactaagaaactacatagac 789

                                                                   
Query: 790 attgctgagaatgcaaagaaagttgggtttgaggttgtgagagagaaggatttggc 845
           || || ||||  || | |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 790 atagcagagacagcgaggaaagtaggatttgaggtagtgaaagaaaaggatttggc 845



 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 109 ctctccggcggctctattgcagccgagaaagtccaagacaaatacaatcaatattggtcc 168
           |||||||||||||| ||  | || || |||||||||||||| ||||| ||||| ||||| 
Sbjct: 109 ctctccggcggctccatctccgcagaaaaagtccaagacaactacaaacaatactggtca 168

                   
Query: 169 ttctttcg 176
           ||||||||
Sbjct: 169 ttctttcg 176