Jatropha Genome Database

JcCA0138821.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0138821.10 + phase: 0 
         (222 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29711.m000322 DNA binding protein, putative                            88   2e-17
29830.m001386 DNA binding protein, putative                            54   3e-07

>29711.m000322 DNA binding protein, putative
          Length = 951

 Score = 87.7 bits (44), Expect = 2e-17
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 141 gaaggctgaccgtgagaagttgaggagggatcgactaaatgagcaatttattgagttggg 200
           ||||||||| ||||| |||||||||||||||||| |||||||||| ||||||||||||||
Sbjct: 114 gaaggctgatcgtgaaaagttgaggagggatcgattaaatgagcattttattgagttggg 173


>29830.m001386 DNA binding protein, putative
          Length = 954

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 133 aaagttctgaaggctgaccgtgagaagttgaggagggatcgactaaatgagcaatttatt 192
           ||||||| |||||| || ||||| || |||||||| || |||||||||||||| ||  ||
Sbjct: 127 aaagttcagaaggcagatcgtgaaaaattgaggagagaccgactaaatgagcagttcctt 186

                      
Query: 193 gagttgggaaa 203
           ||| |||||||
Sbjct: 187 gagctgggaaa 197