Jatropha Genome Database
- JcCA0138571.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0138571.10 + phase: 0 /pseudo/partial
(435 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30078.m002305 conserved hypothetical protein 137 6e-32
>30078.m002305 conserved hypothetical protein
Length = 321
Score = 137 bits (69), Expect = 6e-32
Identities = 129/149 (86%)
Strand = Plus / Plus
Query: 253 gagttgcttctagggttagtgttctgtttttgggcagccttaactgtaccgggaaagttc 312
|||||||||||||| |||||||| ||| | ||||| || ||||||| || |||||||||
Sbjct: 136 gagttgcttctaggattagtgttatgtatgtgggccgctttaactgcgccaggaaagttc 195
Query: 313 cgatccatacacccttattctgatgaaaataggatagtttctttacccgctaatatggac 372
| ||||||||||||| ||||||| || ||||| ||||| |||||||| | |||||||||
Sbjct: 196 ctatccatacaccctcattctgaagagaatagaatagtctctttaccagacaatatggac 255
Query: 373 ttcatggtctttaaccatcgtggcaaagt 401
|||||| |||| |||||||||||||||||
Sbjct: 256 ttcatgatcttcaaccatcgtggcaaagt 284
Score = 71.9 bits (36), Expect = 3e-12
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 76 tgaagattatggaggaggaattttcaggacctccaatgaatgtg 119
||||||| ||||||||||||||| ||||||||||||||||||||
Sbjct: 86 tgaagatcatggaggaggaatttgcaggacctccaatgaatgtg 129