Jatropha Genome Database

JcCA0136421.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0136421.10 + phase: 0 /partial
         (507 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29625.m000722 carbonic anhydrase, putative                             64   9e-10

>29625.m000722 carbonic anhydrase, putative
          Length = 828

 Score = 63.9 bits (32), Expect = 9e-10
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 316 ttcagatatattggttctcttaccactcctccatgtactgaaaatgtcatctggaa 371
           ||||||||| |||| |||||||||||||||||||| || ||  |||||||||||||
Sbjct: 628 ttcagatatgttggctctcttaccactcctccatgcacagaggatgtcatctggaa 683