Jatropha Genome Database

JcCA0134311.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0134311.20 - phase: 0 
         (180 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29929.m004706 conserved hypothetical protein                           72   1e-12

>29929.m004706 conserved hypothetical protein
          Length = 177

 Score = 71.9 bits (36), Expect = 1e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                  
Query: 1  atggattcagggccatcctgggctgatcaatgggacaatgacactcctgacactcc 56
          ||||||||||||| |||||||||||| ||||||||| ||||||| |||||| ||||
Sbjct: 1  atggattcagggctatcctgggctgaccaatgggactatgacacccctgaccctcc 56