Jatropha Genome Database
- JcCA0134311.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0134311.20 - phase: 0
(180 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29929.m004706 conserved hypothetical protein 72 1e-12
>29929.m004706 conserved hypothetical protein
Length = 177
Score = 71.9 bits (36), Expect = 1e-12
Identities = 51/56 (91%)
Strand = Plus / Plus
Query: 1 atggattcagggccatcctgggctgatcaatgggacaatgacactcctgacactcc 56
||||||||||||| |||||||||||| ||||||||| ||||||| |||||| ||||
Sbjct: 1 atggattcagggctatcctgggctgaccaatgggactatgacacccctgaccctcc 56