Jatropha Genome Database

JcCA0131621.10

BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0131621.10 - phase: 0 /partial
         (858 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30024.m001744 conserved hypothetical protein                           62   6e-09

>30024.m001744 conserved hypothetical protein
          Length = 819

 Score = 61.9 bits (31), Expect = 6e-09
 Identities = 169/215 (78%)
 Strand = Plus / Plus

                                                                       
Query: 313 cggtttcctaagattgttggctcttgcaatggtcttatttgtcttgatatctccccttgc 372
           |||||||| |||||  |||| |||| ||||||||||  |||||||||||| || || |  
Sbjct: 61  cggtttcccaagatcattggttcttccaatggtcttccttgtcttgatatttcgccctat 120

                                                                       
Query: 373 tatgcttttggttttgttttatggaatattacgactaagcaatataagtttctccctaga 432
           ||||| |  || |||||  | |||||| |||| | |||||||| || ||||||  |||||
Sbjct: 121 tatgcctcagggtttgtgctctggaattttaccattaagcaatttaggtttcttgctaga 180

                                                                       
Query: 433 ccaagaatcaatgatgcccataaacctatatggatggtggcaactgggtttgggtataat 492
           |||| ||| | ||||| |  |||| |  | ||||||||||| ||| ||||||| | ||||
Sbjct: 181 ccaacaattagtgatggcattaaatccttttggatggtggctactaggtttggatttaat 240

                                              
Query: 493 cgccgagataatgattataaactggtgaggattgt 527
           |  | |  |||||||||||||||||| ||||||||
Sbjct: 241 caacaaactaatgattataaactggtaaggattgt 275