Jatropha Genome Database

JcCA0122071.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0122071.10 + phase: 0 
         (411 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29977.m000249 DNA binding protein, putative                           100   1e-20

>29977.m000249 DNA binding protein, putative
          Length = 705

 Score = 99.6 bits (50), Expect = 1e-20
 Identities = 80/90 (88%)
 Strand = Plus / Plus

                                                                       
Query: 286 tctgctgaatcggcgagttggttgccgccgggatggttggttgaagatcgggttaggacc 345
           |||||||| || |||| ||||||||||||||| ||||||||||||||| |||||||| ||
Sbjct: 277 tctgctgactctgcgaattggttgccgccgggttggttggttgaagatagggttagggcc 336

                                         
Query: 346 tcaggtgcaacagctggcacggtagataag 375
           || ||||| ||||||||||| || ||||||
Sbjct: 337 tccggtgctacagctggcactgtcgataag 366