Jatropha Genome Database
- JcCA0122071.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0122071.10 + phase: 0
(411 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29977.m000249 DNA binding protein, putative 100 1e-20
>29977.m000249 DNA binding protein, putative
Length = 705
Score = 99.6 bits (50), Expect = 1e-20
Identities = 80/90 (88%)
Strand = Plus / Plus
Query: 286 tctgctgaatcggcgagttggttgccgccgggatggttggttgaagatcgggttaggacc 345
|||||||| || |||| ||||||||||||||| ||||||||||||||| |||||||| ||
Sbjct: 277 tctgctgactctgcgaattggttgccgccgggttggttggttgaagatagggttagggcc 336
Query: 346 tcaggtgcaacagctggcacggtagataag 375
|| ||||| ||||||||||| || ||||||
Sbjct: 337 tccggtgctacagctggcactgtcgataag 366