Jatropha Genome Database

JcCA0111271.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0111271.10 + phase: 0 /partial
         (1218 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29840.m000603 (+)-delta-cadinene synthase isozyme A, putative          68   1e-10

>29840.m000603 (+)-delta-cadinene synthase isozyme A, putative
          Length = 1653

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                       
Query: 660 gtggtggaaagatttaaattttgcaacaaagctaccatttgcaagagacaggatcgttga 719
           |||||||||||||||| |||||| ||  ||||| || ||| || |||||||| |||| ||
Sbjct: 759 gtggtggaaagatttagattttgtaaacaagctcccttttacacgagacagggtcgtgga 818

                             
Query: 720 gtgttacttttggatatt 737
           | ||||||||||||||||
Sbjct: 819 gggttacttttggatatt 836