Jatropha Genome Database
- JcCA0090671.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0090671.10 - phase: 0 /partial
(357 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29864.m001463 Angio-associated migratory cell protein, putative 321 2e-87
>29864.m001463 Angio-associated migratory cell protein, putative
Length = 1416
Score = 321 bits (162), Expect = 2e-87
Identities = 237/262 (90%)
Strand = Plus / Plus
Query: 4 cacaaaaaatggattactggcatctcttgggaaccagtccacttgaatgcaccatgccgc 63
|||||||||||||| ||||| ||||| ||||||||||||||||||| || || |||||
Sbjct: 568 cacaaaaaatggatcactggtatctcctgggaaccagtccacttgagcgctccgtgccgt 627
Query: 64 cggtttgttagtgctagcaaagatggtgatgcacgcatttgggatgtttcattaaggaaa 123
|||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||
Sbjct: 628 cggtttgttagtgctagcaaagatggtgatgcacgcatatgggacgtttcattgaggaag 687
Query: 124 tgtgttatttgtcttactggccacacacttgcaataacatgtgtgaaatggggtggagat 183
|||||||||| ||| ||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 688 tgtgttatttctctcactggtcatacacttgctataacttgtgtgaaatggggtggagac 747
Query: 184 ggattaatttatacaggctcccaagattgtaccatcaaagtctgggagaccacacagggg 243
||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 748 ggagtaatttatacaggctcccaagattgtaccatcaaagtttgggagactacacaggga 807
Query: 244 aagttagttcgtgaattaaagg 265
|||||| |||||||||| ||||
Sbjct: 808 aagttaattcgtgaattgaagg 829