Jatropha Genome Database

JcCA0081341.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0081341.10 + phase: 2 /partial
         (211 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30055.m001561 60S ribosomal protein L10a, putative                     68   2e-11

>30055.m001561 60S ribosomal protein L10a, putative
          Length = 657

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 74  tttactgggacaattgagcttcagattggactgaagaactatgatccccaaaaagacaag 133
           ||||||| ||| |||||||| |||||||| || |||||||||||||| ||||| ||||| 
Sbjct: 100 tttactgagactattgagctccagattgggctcaagaactatgatcctcaaaaggacaaa 159

                                                                       
Query: 134 agatccagcggctctgttaagcttcctcacattcctcgccccaagatgaaaatctgcatg 193
            | | ||| || ||||| ||| | || || || || ||||| || |||||||| || |||
Sbjct: 160 cgtttcagtggttctgtgaagttgccacatatcccccgccctaaaatgaaaatttgtatg 219

                         
Query: 194 cttggtgatgctca 207
           ||||| ||||||||
Sbjct: 220 cttggagatgctca 233